ارزيابي واكنش زنجيره اي پلي مر از (PCR) در تشخيص ليشمانيوز جلدي بر روی نمونه های پوستی بیوپسی شده پارافینی
 

- +
عنوان
ایمیل  
 

مدیر سایت ارسال کننده
دكتر اكبر صفايي- دكتر محمدحسين معتضديان- دكتر محمد واسعي نویسنده / نويسندگان
مترجم
ليشمانيوز جلدي، واكنش زنجيره اي پلي مراز، تشخيص بر روي بلوكهاي پارافيني کلید واژه
در اين مطالعه از واكنش زنجيره اي پلي¬مراز (PCR) در تشخيص ليشمانيوز جلدي به وسيلة آغازگرهاي (Primers) اختصاصي بر روي DNA به دست آمده از بلوك¬هاي پارافيني نمونه هاي پوستي بيوپسي شده استفاده گرديد. با اين روش قسمتي از DNA كينتوپلاستي كه حاوي 120 جفت باز مي باشد تكثير داده مي شود و به وسيله الكتروفورزيس وجود DNA انگل بررسي مي گردد. در تمام 32 بيماري كه از نظر باليني مشكوك به ليشمانيوز جلدي بوده و در بررسي ميكروسكوپي جسم ليشمن مشاهده شده بود PCR مثبت گرديد و از 29 بيماري كه از نظر باليني مشكوك به ليشمانيوز جلدي بوده اما در بررسي ميكروسكوپي جسم ليشمن مشاهده نگرديده بود PCR در 24 مورد (7/82%) مثبت گرديد. PCR بر روي 10 بيماري كه از نظر باليني و يافته هاي هيستومورفولوژيكي بيماريهاي پوستي ديگري غير از ليشمانيازيس مطرح بوده است. و مشكوك به ليشمانيوز جلدي نبوده اند، در تمام موارد منفي بود. حساسيت تست (PCR) در تشخيص 61 بيماري كه از نظر باليني مشكوك به بيماري ليشمانيوز جلدي بوده¬اند 8/91% بود در صورتي كه تشخيص به وسيله يافته¬هاي هيستومورفولوژيكي حساسيتي معادل 6/51 درصد داشت. اين يافته ها نشان دهندة اين است كه (PCR) بر روي DNA به دست آمده از بلوك هاي پارافيني نمونه هاي پوستي بيوپسي شده يك روش ارزشمند در تشخيص ليشمانيوز جلدي، مخصوصاً در مواردي كه جسم ليشمن مشاهده نمي¬شود مي باشد. چکیده
مجله دانشگاه علوم¬پزشكي و خدمات بهداشتي درماني شهيد صدوقي يزد - سال نهم، شماره دوم، تابستان 1380، ص 55 - ارسالی از طرف کاربر ahad منابع
. .
  

مجله دانشگاه علوم­پزشكي و خدمات بهداشتي درماني شهيد صدوقي يزد

سال نهم، شماره دوم، تابستان 1380، ص 55

ارزيابي واكنش زنجيره­اي پلي­مر از (PCR) در تشخيص ليشمانيوز جلدي بر

روي نمونه­هاي پوستي بيوپسي شدة پارافيني

دكتر اكبر صفايي- دكتر محمدحسين معتضديان- دكتر محمد واسعي

در اين مطالعه از واكنش زنجيره­اي پلي­مراز (PCR) در تشخيص ليشمانيوز جلدي به وسيلة آغازگرهاي (Primers) اختصاصي بر روي DNA به دست آمده از بلوك­هاي پارافيني نمونه­هاي پوستي بيوپسي شده استفاده گرديد. با اين روش قسمتي از DNA كينتوپلاستي كه حاوي 120 جفت باز مي­باشد تكثير داده مي­شود و به وسيله الكتروفورزيس وجود DNA انگل بررسي مي­گردد. در تمام 32 بيماري كه از نظر باليني مشكوك به ليشمانيوز جلدي بوده و در بررسي ميكروسكوپي جسم ليشمن مشاهده شده بود PCR مثبت گرديد و از 29 بيماري كه از نظر باليني مشكوك به ليشمانيوز جلدي بوده اما در بررسي ميكروسكوپي جسم ليشمن مشاهده نگرديده بود PCR در 24 مورد (7/82%) مثبت گرديد. PCR بر روي 10 بيماري كه از نظر باليني و يافته­هاي هيستومورفولوژيكي بيماريهاي پوستي ديگري غير از ليشمانيازيس مطرح بوده است. و مشكوك به ليشمانيوز جلدي نبوده­اند، در تمام موارد منفي بود. حساسيت تست (PCR) در تشخيص 61 بيماري كه از نظر باليني مشكوك به بيماري ليشمانيوز جلدي بوده­اند 8/91% بود در صورتي كه تشخيص به وسيله يافته­هاي هيستومورفولوژيكي حساسيتي معادل 6/51 درصد داشت. اين يافته­ها نشان دهندة اين است كه (PCR) بر روي DNA به دست آمده از بلوك­هاي پارافيني نمونه­هاي پوستي بيوپسي شده يك روش ارزشمند در تشخيص ليشمانيوز جلدي، مخصوصاً در مواردي كه جسم ليشمن مشاهده نمي­شود مي­باشد.


واژه­هاي كليدي: ليشمانيوز جلدي، واكنش زنجيره­اي پلي­مراز، تشخيص بر روي بلوكهاي پارافيني


مقدمه

ليشمانيازيس يكي از بيماريهاي شايع در جنوب ايران مي­باشد كه به صورت ليشمانيوز جلدي، احشايي و جلدي- مخاطي ديده مي­شود. روش­هاي تشخيص زيادي جهت اين بيماري مورد استفاده قرار مي­گيرد كه

1- دستيار گروه آسيب­شناسي

2- استاديار گروه ميكروبيولوژي

3- استاديار گروه آسيب­شناسي

دانشگاه علوم پزشكي و خدمات بهداشتي درماني شيراز

از آن جمله مي­توان تهيه اسمير مستقيم، بيوپسي پوستي، كشت در محيط­هاي آزمايشگاهي، تلقيح به حيوانات آزمايشگاهي، تست بيوپسي، سرولوژي و آنتي­بادي منو كلونال را نام برد(3،2،1). در حال حاضر روشهاي معمول جهت تشخيص قطعي بيماري بر اساس مشاهده جسم ليشمن در اسمير مستقيم و بيوپسي بافتي يا كشت در محيط­هاي آزمايشگاهي و تلقيح به حيوانات مي­باشد(2).

تشخيص به وسيلة مشاهدة جسم ليشمن در نمونه}هاي اسمير مستقيم و بيوپسي از ويژگي و حساسيت بالايي برخوردار نمي­باشد(4،2) و كشت در محيط­هاي آزمايشگاهي و تلقيح به حيوانات آزمايشگاهي روش­هاي وقت­گير و پردردسري هستند و در ضمن حساسيت و ويژگي بالايي ندارند(1،4).

واكنش زنجيره­اي پلي­مراز روشي است كه مي­تواند ليشمانيوز جلدي را حتي در صورت وجود تعداد بسيار كمي انگل، تشخيص دهد(1،5). در حال حاضر اليگو نوكلئوتيدهاي آغازگر اختصاصي براي DNA كينتوپلاستي انگل ليشمانيا در دسترس مي­باشد(6،7،8) و از آنها در تشخيص بيماري بر روي بافت تازه، يخ زده و بلوك­هاي پارافيني استفاده شده است(7،8،9). روشي كه بطور معمول جهت آماده­سازي بافت­ها براي بررسي در آزمايشگاه­هاي آسيب­شناسي مورد استفاده قرار مي‌گيرد تهيه بلوك پارافيني از بافت­ها مي­باشد به همين خاطر در اين مطالعه توانايي PCR در تشخيص ليشمانيوز جلدي بر روي DNA به دست آمده از نمونه­هاي پوستي بيوپسي شده پارافيني بيماران مبتلا به ليشمانيوز جلدي كه جسم ليشمن ديده مي­شود ارزيابي شده است و از آن در تشخيص بيماراني كه از نظر باليني مشكوك به ليشمانيوز جلدي بوده­اند اما در بررسي ميكروسكوپي جسم ليشمن مشاهده نشده، استفاده گرديده است.

روش بررسي

1- انتخاب نمونه­ها: در اين مطالعه 71 بيمار مبتلا به ضايعات پوستي كه بيوپسي آنها در طي سالهاي 1371 الي 1378 به بخش آسيب­شناسي دانشكدة علوم پزشكي شيراز فرستاده شده است مورد بررسي قرار گرفتند و بر اساس يافته­هاي باليني و هيستومورفولوژيكي به سه گروه تقسيم شدند. گروه اول: 32 بيمار كه از نظر باليني مشكوك به ليشمانيوز جلدي بوده­اند و در بررسي ميكروسكوپي جسم ليشمن مشاهده گرديد. گروه دوم: 29 بيماري كه از نظر باليني مشكوك به ليشمانيوز جلدي بوده­اند اما در بررسي ميكروسكوپي جسم ليشمن مشاهده نگرديد. گروه سوم: 10 بيمار كه از نظر باليني و هيستومورفولوژيكي مشكوك به ليشمانيوز جلدي نبوده­اند و مبتلا به ضايعات پوستي ديگر بوده­اند كه شامل چهار بيمار مبتلا به جذام، دو بيمار مبتلا به اگزماي مزمن، يك بيمار مبتلا به ليكن سيمپلكس مزمن (licken simplex chronicus)، يك بيمار مبتلا به ليكن پلان، يك بيمار مبتلا به كراتوزپالموپلانتار (Palmoplantar keratosis) و يك بيمار مبتلا به خال پوستي بود.

2- استخراج DNA: جهت استخراج DNA از بلوك­هاي پارافيني سه عدد برش 15 ميكروني توسط ميكروتوم تهيه گرديد و در داخل لوله­هاي 5/1 سي­سي اپندورف (Eppendorf) گذاشته شدند. جهت جلوگيري از آلودگي DNA بعد از برش هر بلوك، تيغه برش، گيرة تيغه و محيط اطراف كاربا محلول سديم هيپوكلريت mM100 تميز مي­گرديد(10). نمونه­هاي بريده شده به وسيله الكل وازيلول پارافين­زدايي شدند و پس از خشك شدن، بافت­ها به وسيلة ميله­هاي شيشه­اي استريل شده خرد گرديدند و به هر لوله 100 ميكروليتر با فر (Tris-Hcl 10mM, EDTA 1mM)TE اضافه گرديد و به مدت 15 دقيقه در حمام آب جوش گذاشته شدند. سپس نمونه­ها با دور 14000 به مدت 15 دقيقه سانتريفيوز گرديدند و از محلول رويي به عنوان منبع DNA جهت انجام PCR استفاده گرديد(9). اين محلول تا قبل از انجام آزمايش به لوله­هاي استريل منتقل شدند و در دماي ºc4 نگهداري گرديدند.

3- تهيه نمونه كنترل مثبت و منفي

جهت تهيه كنترل مثبت 100 ميكروليتر از محيط كشت حاوي انگل پروماستيگوت را با 400 ميكروليتر از پلاسماي شخص سالم مخلوط كرده سپس به آن ترومبوپلاستين بافتي و كلسيم اضافه گرديد تا به صورت لخته درآيد. از اين لخته بلوك پارافيني تهيه شد و از اين بلوك همانند روش قبلي برش صورت گرفت و DNA آن استخراج گرديد و به عنوان نمونه كنترل مثبت در نظر گرفته شد. جهت نمونه كنترل منفي به جاي DNA در واكنش PCR از آب مقطر استفاده شد.

4- آزمايش PCR:

جهت انجام PCR از آغازگر A13 (´3 TGGGGGAGGGGCGTTCT ´5) و B 13 (´3 ATTTTACACCAACCCCAGTT ´5) جهت تكثير قسمتي از DNA كينتوپلاست كه حاوي 120 جفت باز مي­باشد استفاده گرديد(6،9). محلول PCR تهيه شده شامل 5/2 ميكروليتر از محلول 25 ميلي مول داكسي نوكلئوزيد تري فسفات (dNTP)، 2 ميكروليتر از محلول 25 ميلي­مول كلريد منيزيم، 5/2 ميكروليتر از بافر PCR 10X، 2/0 ميكروليتر از محلول 5 واحد در ميكروليتر Taq DNA polymerase، 5/0 ميكروليتر از آغازگر A 13، 5/0 ميكروليتر از آغازگر B13، 3 ميكروليتر از محلول حاوي DNA استخراج شده و 8/13 ميكروليتر آب مقطر جهت رساندن حجم محلول PCR در دستگاه ترموسيكلر با برنامه­ريز جهت يك دور گذاشته شدند:

1- درجه حرارت ºc 94 به مدت يك دقيقه جهت جدا شدن زنجيره­هاي DNA از هم 2- درجه حرارت ºc 54 به مدت يك دقيقه جهت چسبيدن آغازگرها به زنجيره­هاي تكي DNA 3- درجه حرارت °c 72 به مدت يك دقيقه جهت گسترش زنجيره جديد DNA اين برنامه براي هر سري تست PCR 25 بار تكرار مي­گرديد(9). لازم به ذكر است كه در هر سري PCR يك نمونه كنترل مثبت و يك نمونه كنترل منفي نيز گذاشته مي­شد تا جلو خطاهاي احتمالي گرفته شود. پس از انجام PCR جهت تشخيص واكنش 10 ميكروليتر از محلول PCR را داخل چاهك­هاي مخصوص ژل اگاروز 2/1% كه به آن اتيديوم بروميد جهت رنگ­آميزي DNA اضافه شده است ريخته و سپس الكتروفورز انجام مي­گرديد و از نظر وجود باند DNA موردنظر توسط لامپ uv مورد بررسي قرار مي­گرفت و در صورت وجود باند DNA مثبت تلقي مي­شد.

نتايج

1- PCR بر روي DNA بدست آمده از بلوك­هاي پارافيني 32 بيماري كه از نظر باليني مشكوك به ليشمانيوز جلدي بوده­اند و در بررسي ميكروسكوپي نيز جسم ليشمن مشاهده شده بود در تمام موارد مثبت بود و منفي كاذب وجود نداشت.

2- PCR بر روي DNA بدست آمده از بلوك­هاي پارافيني 29 بيماري كه از نظر باليني مشكوك به ليشمانيوز جلدي بوده­اند ولي در بررسي ميكروسكوپي جسم ليشمن مشاهده نشده بود در 24 مورد (7/82%) مثبت و در 5 مورد (3/17%) منفي بود.

3- PCR بر روي DNA بدست آمده از بلوك­هاي پارافيني 10 بيماري كه از نظر باليني و هيستومورفولوژيكي مشكوك به ليشمانيازيس نبوده­اند و بيماريهاي پوستي ديگر مطرح بوده است در تمام موارد منفي بود و مورد مثبت كاذب وجود نداشت. (جدول 1 و تصوير 1)

جدول 1: تست PCR در بيماران مبتلا و مشكوك به ليشمانيوز

جلدي و بيماريهاي پوستي ديگر

تشخيص بيماري

تعداد

موارد مثبت PCR

Cutaneous Leish

33

33 (100%)

Suggestive leish

29

24 (7/82%)

Skin disease other than leish

10

0 (0%)

تصوير 1: الكتروفورز محصولات PCR: رديف شماره 1 كنترل منفي، رديف شماره 2 كنترل مثبت، رديف شماره 3 و 4 از گروه بيماريهاي پوستي غير از ليشمانيازيس، رديف 5 و 6 و 7 از گروه بيماران مشكوك به ليشمانيازيس كه جسم ليشمن مشاهده شده است و رديف 8 و 9 و 10 از گروه بيماران مشكوك به ليشمانيازيس كه جسم ليشمن مشاهده نشده است، رديف 11 ماركر DNA كه آخرين باند آن معرف 564 كيلو بايت مي­باشد.

بحث و نتيجه­گيري

جهت تشخيص ليشمانيوز جلدي روش­هاي بسياري مورد استفاده قرار مي­گيرد كه روش معمول براساس مشاهده جسم ليشمن در نمونه­هاي اسير مستقيم، بيوپسي بافتي يا كشت در محيط­هاي آزمايشگاهي مي}باشد كه جهت مثبت شدن نياز به وجود تعداد زيادي جسم ليشمن مي­باشد(1). ليشمانيوز جلدي مزمن از نظر مورفولوژي به صورت يك ضايعه گرانولوماتوز مزمن مي­باشد و به ندرت جسم ليشمن مشاهده مي­شود بنابراين تشخيص قطعي بيماري و افتراق آن از بيماريهاي گرانولوماتوز ديگر از جمله سل و جذام بسيار مشكل مي­باشد(9).

PCR روشي است با حساسيت و ويژگي بالا كه در تشخيص بسياري از بيماريها از جمله بيماريهاي عفوني مانند ويروس­ها، باكتريها و انگل­ها مورد استفاده قرار مي­گيرد. PCR قادر است ليشمانيوز جلدي را حتي در صورت وجود تعداد اندكي انگل تشخيص دهد(1،5). در مطالعات قبلي از اين روش بر روي DNA به دست آمده از نمونه­هاي اسير مستقيم، بافت تازه، بافت يخ زده و همچنين بلوك­هاي پارافيني استفاده شده است(7،8،9،11).

در مطالعاتي كه قبلاً به وسيله PCR جهت تشخيص ليشمانيوز جلدي انجام شده همگي نشان دهنده حساسيت و ويژگي بالاي اين روش در مقابل روش­هاي معمول ديگر مي­باشد(14،9). در اين مطالعه از بلوك­هاي پارافيني نمونه­هاي پوستي بيوپسي شده جهت PCR استفاده گرديد و از روش جوشاندن جهت استخراج DNA استفاده شد كه روش بسيار سريع و راحتي مي‌باشد(7،8،9،12).

PCR بر روي DNA به دست آمده از بلوك­هاي پارافيني بيماراني كه از نظر باليني مشكوك به ليشمانيوز جلدي بوده­اند و جسم ليشمن مشاهده گرديده بود در تمام موارد مثبت بود و مورد منفي كاذب وجود نداشت و بر روي نمونه­هاي بيماراني كه از نظر باليني مشكوك به ليشمانيوز جلدي بوده­اند اما در بررسي ميكروسكوپي جسم ليشمن مشاهده نشده بود در 7/82 درصد مثبت گرديد. همچنين PCR در بيماراني كه ضايعات پوستي ديگري غير از ليشمانيوز پوستي داشتند در تمام موارد منفي بود و مورد مثبت كاذب وجود نداشت كه اين نشان­دهنده ويژگي بالاي اين روش مي­باشد. در اين مطالعه حساسيت PCR در تشخيص بيماراني كه از نظر باليني مشكوك به ليشمانيازيس بوده­اند 8/91 درصد و در مقابل به وسيله بررسي هيستوپاتولوژيكي 6/51 درصد بود. بنابراين PCR روشي راحت، سريع، مناسب و با حساسيت و ويژگي بالا جهت تشخيص ليشمانيوز جلدي مي­باشد و در موارد مزمن كه با روش­هاي ديگر امكان يافتن جسم ليشمن بسيار كم است و تشخيص قطعي بيماري مشكل است، بسيار كمك كننده مي­باشد. همچنين مي­توان از PCR به عنوان يك روش مناسب در مطالعات اپيدميولوژيكي و در مطالعات گذشته­نگر بر روي بلوك‌هاي پارافيني استفاده نمود.


1- Debra chester kalter. Laboratory tests for the diagnosis and evaluation of leishmanasis.

Dermatol Clin 1994, 12(1): PP: 37-50.

2- Suzanne A. Grevelink, Ethan A. Lerner. Leishmaniasis. J. Am. Acat. Dermatol, 1996, 34(2); PP: 257-272.

3- Navin TR, Arana FE, de Merida AM, et al. Cutaneous Leishmaniasis in Guatemala:

Comparison of diagnostic method. Am J Trop Med Hyg, 1990, 42; PP: 36-42.

4- Kurban, Ak, Malad JA, Farah FS, et al. Histopathology of cutaneaus leishmaniasis, Arch Dermat, 1966, 93: PP:396-401.

5- Wirth D, McMahon- Pratt D. Rapid identification of leishmania species by specific hybridization of kinetoplast DNA in cutaneous lesions. Proc Natl Acad Sci USA, 1982, 79; PP: 6999- 7003.

6- Rodgers, M.R., popper S.J. wirth, D.F. Amplification of kinetoplast DNA as a tool in the detection and diagnosis of leishmania. Experimental parasitology, 1990, 71; PP: 267-257.

7- Lopez M.Inga,R., Cangalaya, M., Echevarria, J., Llanos cuentas, A. orrege, C. & Arevalo, J. Diagnosis of leishmania using the polymerase chain reation: a simplified procedure for field work. American journal of Tropical Med, 1993, 49; PP: 384- 356.

8- Smyth, A.J., Ghosh, A., Hassan, M.Q.,et al. Rapid and sensitive detection of leishmania kinetoplast DNA from splenn and blood samples of kala- azar patient. Parasitology, 1992, 105; PP: 183- 192.

9- Tamas, L, Tivadar. LM, Yohannes, N, et al, Detection of cutaneaus leishmania infection in paraffin- embedded skin biopsies using, the polymerase chain reaction. Trans- Roy- Sco- Trop- Med- Hyg- 1995, 86; PP: 273- 275.

10- Prince, A.M., Anderus, L. PCR: How to kill unwanted DNA. Biotechniques, 1992, 12; PP: 358- 360.

11- Mimori- T, Sasali- J, Nakata- M, Gomez- EA ant et al. Rapid identification of leishmania species from formalin- fixed biopsy samples by polymorphism- species polymerase chain reaction. Gene, 1998 apr 14; 210 (2); PP: 179-86.

12- Belli- A; Rodriguez- B; A viles- H; Harris- E. Simolified polymerase chain reaction detection of new world leishmania in clinical specimens of cutaneaus leishmanianis. Am- J- Trop- Med- Hyg. 1998, Jan, 58(1); PP: 102-109.





نام کاربری :
نام رمز :
 

میکروبیولوژی (میکروب شناسی)

ایمونولوژی (ایمنی شناسی)

کنترل کیفی

هماتولوژی (خون شناسی)

بیوشیمی

بانک خون

پاتولوژی (آسیب شناسی)

مایعات بدن

ژنتیک

بیوتکنولوژی (زیست فن آوری)

نانوتکنولوژی

سم شناسی

تومور مارکر

آندرولوژی

بیولوژی سلولی و مولکولی

کلیه حقوق معنوی و مادی این سایت برای شرکت تحقیقاتی تولیدی فارمد آوران سبز محفوظ است 2017®

کورتیزول, باکتریوفاژها, نرمال, عوامل انعقادى, سانترومری, دترژانت, لوسمي, ایزو تیوسیانات‌ها, رزیدنت, کالیفرنیا, مرحله G2 به M, تشخیص زود هنگام سرطان , خوردن غذاهای چرب, Lanceolatum, لاکتیس, هایپرکرومیا, مکیدن, میکرولیتیس, مگالوبلاست, هیپوگلیسمی, بیماری سرماخوردگی, شته‌ای, احساس سیری, سوبتيليس, سارکوم, سدیمان, دکتر زهرا ریخته گران تهرانی, مينور, عفونتهای, هایپربیلی, D-Dimer, انتي بادي عاي بلوکان, مالتیپل, گرانولهاي, نفرولوژیست, ترانسفورماسیون, عوامل بیماریزا , viroid, دروکسوبین, آنتی‌اکسیدان‌های, مورنر, تستهای, استافیلوکک, هیدروکسیلاسیون, بررسي عفونت در محيط كشت, Health, فلایشمان, Persesche, مالاکوپلاکیا, Microcyte, لام, Sartorius, جنتامايسين, ESR, انتخابگري, میکروسکوپ, فيزيولوژي, الیگومنوره, آنزیم لخته کننده سرین پروتئاز, HSV-1, سرولوژیک, چربي, هییپرتیروئیدی, آئدس, بارتونلا, هماتولوژی, وسترن, بتاتالاسمي, آب, درماتوفیت,